[Numpy-discussion] how to store variable length string in array and get single char by it's position?

kee chen keekychen.shared@gmail....
Tue Sep 14 11:25:15 CDT 2010


Dear All,

Suppose I have a list group some kind like DNA sequence:

1  ATGCATGCAATTGGCC
 2  ATGCATGCAATTGGCCATCD
 3  CATGCAATTGGCCCCCCCCC
......
100000 CATGCAAATTGGCCCCCCCCC

the string length of each item is not sure and may get change/update later,
then how can I store above in a numpy array (include the ID) and easy to get
the single value?

for example
1.  ATGCATGCAATTGGCC
I want get the first T then I use something like array[1][1], means
A[T]G......   and if I want to update the 3rd postion I can use array[1][2]
= T to set the AT[G]C... to AT[T]C...?


Thanks for any hints.


Rgs,
KC
-------------- next part --------------
An HTML attachment was scrubbed...
URL: http://mail.scipy.org/pipermail/numpy-discussion/attachments/20100915/4046aa1c/attachment.html 


More information about the NumPy-Discussion mailing list